BCL11A

This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. RefSeq, Jul 2008
B-cell lymphoma/leukemia 11A is a protein that in humans is encoded by the BCL11A gene.wikipedia

BCL11A


ENCODE experiments
Ensemble search
Entrez 53335
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia BCL11A

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHA

loading

H1-hESC - Myers - ENCSR000BIP

loading

H1-hESC - Myers - ENCSR000BMJ

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHA

1.
198 / 500
3.9e-231
AAAGAGGAAGTGAAACTAG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.08
2.
267 / 500
1.0e-143
TGAGTCATATCGAGA
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 2.18
3.
183 / 500
8.3e-75
TGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.59
4.
35 / 500
0.000058
CCCCAGGGGAA
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.71
5.
30 / 500
0.0000075
TGGGGGAGGGGGAGG
small heat map img p-value: 0.01
pct_center: 0.25
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Myers - ENCSR000BMJ

1.
40 / 500
4.7e-203
TGGGTGATCAGTGCAGAGATATGTCAAAA
small heat map img p-value: 0.14
pct_center: 0.12
pct_ratio: 0.56
2.
35 / 500
2.0e-151
TAGGCAAAGCCTAGAAAATTGTTGCATCAC
small heat map img p-value: 0.01
pct_center: 0.13
pct_ratio: 0.65
3.
126 / 500
4.2e-67
ATTTGCATGACAAAG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.25
4.
17 / 500
9.0e-67
ATGGAATGGAATGGAATGGAATGG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.55
5.
148 / 500
1.3e-66
GCACAGCAGGA
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.53
MEME output

H1-hESC - Myers - ENCSR000BIP

1.
212 / 500
6.1e-156
GCACAGCAGG
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 1.56
2.
202 / 500
1.6e-127
TTTGCATAACAAAGG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 1.79
3.
14 / 500
7.8e-113
AGAGAACCGGTCTGACTAGAATTCGCCAGG
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.83
4.
136 / 500
2.0e-44
AGGAATGT
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.35
5.
166 / 500
2.3e-24
CCTGGGGG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.73
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at BCL11A peaks

GM12878 - Myers - ENCSR000BHA

GM12878
Myers
BCL11A
ENCSR000BHA
r=1.00

small heat map img

GM12878
Myers
H3K4me2
ENCSR000AKG
r=0.25

small heat map img

GM12878
Myers
H3K27ac
ENCSR000AKC
r=0.23

small heat map img

GM12878
Myers
H3K4me1
ENCSR000AKF
r=0.21

small heat map img

GM12878
Myers
H2AFZ
ENCSR000AOV
r=0.21

small heat map img

GM12878
Myers
H3K4me3
ENCSR000AKA
r=0.21

small heat map img

GM12878
Myers
H3K9ac
ENCSR000AKH
r=0.18

small heat map img

GM12878
Myers
H3K4me3
ENCSR000DRY
r=0.07

small heat map img

GM12878
Myers
H3K79me2
ENCSR000AOW
r=0.03

small heat map img

GM12878
Myers
H4K20me1
ENCSR000AKI
r=0.01

small heat map img

GM12878
Myers
H3K9me3
ENCSR000AOX
r=0.01

small heat map img

GM12878
Myers
H3K36me3
ENCSR000DRW
r=-0.01

small heat map img

GM12878
Myers
H3K36me3
ENCSR000AKE
r=-0.02

small heat map img

GM12878
Myers
H3K27me3
ENCSR000DRX
r=-0.04

small heat map img

GM12878
Myers
H3K27me3
ENCSR000AKD
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 17,876 (download )

H1-hESC - Myers - ENCSR000BIP

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=1.00

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.40

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.29

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.21

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.17

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.17

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.14

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.07

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.05

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=-0.01

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=-0.02

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=-0.03

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=-0.03

small heat map img
2,518 peaks (download )

H1-hESC - Myers - ENCSR000BMJ

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=1.00

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.50

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.25

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.23

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.17

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.17

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.16

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.10

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.09

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=0.05

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=0.03

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=0.01

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=0.00

small heat map img
1,370 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at BCL11A peaks

GM12878 - Myers - ENCSR000BHA

GM12878
Myers
BCL11A
ENCSR000BHA
r=1.00

small heat map img

GM12878
Myers
EP300
ENCSR000DZG
r=0.60

small heat map img

GM12878
Myers
EP300
ENCSR000DZD
r=0.59

small heat map img

GM12878
Myers
RUNX3
ENCSR000BRI
r=0.56

small heat map img

GM12878
Myers
TBL1XR1
ENCSR000DYZ
r=0.53

small heat map img

GM12878
Myers
RELA
ENCSR000EAG
r=0.53

small heat map img

GM12878
Myers
BHLHE40
ENCSR000DZJ
r=0.52

small heat map img

GM12878
Myers
JUND
ENCSR000DYS
r=0.51

small heat map img

GM12878
Myers
SP1
ENCSR000BHK
r=0.51

small heat map img

GM12878
Myers
PAX5
ENCSR000BHJ
r=0.48

small heat map img

GM12878
Myers
FOXM1
ENCSR000BRU
r=0.48

small heat map img

GM12878
Myers
RCOR1
ENCSR000DZC
r=0.48

small heat map img

GM12878
Myers
PAX5
ENCSR000BHD
r=0.48

small heat map img

GM12878
Myers
STAT3
ENCSR000DZV
r=0.47

small heat map img

GM12878
Myers
ATF2
ENCSR000BQK
r=0.47

small heat map img

GM12878
Myers
BATF
ENCSR000BGT
r=0.46

small heat map img

GM12878
Myers
CUX1
ENCSR000DYR
r=0.46

small heat map img

GM12878
Myers
NFIC
ENCSR000BRN
r=0.46

small heat map img

GM12878
Myers
TCF12
ENCSR000BGZ
r=0.46

small heat map img

GM12878
Myers
IKZF1
ENCSR000EUJ
r=0.45

small heat map img

GM12878
Myers
MXI1
ENCSR000DZI
r=0.45

small heat map img

GM12878
Myers
CREB1
ENCSR000BUF
r=0.44

small heat map img

GM12878
Myers
IRF4
ENCSR000BGY
r=0.43

small heat map img

GM12878
Myers
RAD21
ENCSR000EAC
r=0.42

small heat map img

GM12878
Myers
BCL3
ENCSR000BNQ
r=0.42

small heat map img

GM12878
Myers
SMC3
ENCSR000DZP
r=0.41

small heat map img

GM12878
Myers
JUND
ENCSR000EYV
r=0.41

small heat map img

GM12878
Myers
EBF1
ENCSR000BGU
r=0.41

small heat map img

GM12878
Myers
EP300
ENCSR000BHB
r=0.40

small heat map img

GM12878
Myers
NFATC1
ENCSR000BQL
r=0.39

small heat map img

GM12878
Myers
EBF1
ENCSR000DZQ
r=0.38

small heat map img

GM12878
Myers
MAX
ENCSR000DZF
r=0.38

small heat map img

GM12878
Myers
ELK1
ENCSR000DZB
r=0.38

small heat map img

GM12878
Myers
STAT1
ENCSR000DZM
r=0.38

small heat map img

GM12878
Myers
MEF2A
ENCSR000BKB
r=0.38

small heat map img

GM12878
Myers
SREBF1
ENCSR000DYU
r=0.37

small heat map img

GM12878
Myers
ESRRA
ENCSR000DYQ
r=0.37

small heat map img

GM12878
Myers
CEBPB
ENCSR000BRX
r=0.37

small heat map img

GM12878
Myers
TCF3
ENCSR000BQT
r=0.35

small heat map img

GM12878
Myers
STAT5A
ENCSR000BQZ
r=0.34

small heat map img

GM12878
Myers
MTA3
ENCSR000BRH
r=0.34

small heat map img

GM12878
Myers
TBP
ENCSR000DZZ
r=0.33

small heat map img

GM12878
Myers
PML
ENCSR000BQM
r=0.33

small heat map img

GM12878
Myers
SPI1
ENCSR000BGQ
r=0.33

small heat map img

GM12878
Myers
MAFK
ENCSR000DYV
r=0.33

small heat map img

GM12878
Myers
WRNIP1
ENCSR000EAA
r=0.33

small heat map img

GM12878
Myers
POU2F2
ENCSR000BGP
r=0.33

small heat map img

GM12878
Myers
RFX5
ENCSR000DZW
r=0.32

small heat map img

GM12878
Myers
ZNF384
ENCSR000DYP
r=0.32

small heat map img

GM12878
Myers
FOS
ENCSR000EYZ
r=0.31

small heat map img

GM12878
Myers
USF2
ENCSR000DZU
r=0.30

small heat map img

GM12878
Myers
CHD1
ENCSR000DZE
r=0.30

small heat map img

GM12878
Myers
SREBF2
ENCSR000DYT
r=0.29

small heat map img

GM12878
Myers
EZH2
ENCSR000ARD
r=0.28

small heat map img

GM12878
Myers
BRCA1
ENCSR000DZS
r=0.28

small heat map img

GM12878
Myers
SIN3A
ENCSR000DYX
r=0.28

small heat map img

GM12878
Myers
ZNF143
ENCSR000DZL
r=0.27

small heat map img

GM12878
Myers
ELF1
ENCSR000BMB
r=0.27

small heat map img

GM12878
Myers
NRF1
ENCSR000DZO
r=0.27

small heat map img

GM12878
Myers
IRF3
ENCSR000DZX
r=0.26

small heat map img

GM12878
Myers
YY1
ENCSR000BNP
r=0.26

small heat map img

GM12878
Myers
ETS1
ENCSR000BKA
r=0.26

small heat map img

GM12878
Myers
SRF
ENCSR000BMI
r=0.25

small heat map img

GM12878
Myers
E2F4
ENCSR000DYY
r=0.25

small heat map img

GM12878
Myers
NFE2
ENCSR000DZY
r=0.24

small heat map img

GM12878
Myers
NFYB
ENCSR000DNM
r=0.23

small heat map img

GM12878
Myers
YY1
ENCSR000EUM
r=0.21

small heat map img

GM12878
Myers
POLR2A
ENCSR000EAD
r=0.21

small heat map img

GM12878
Myers
MYC
ENCSR000DKU
r=0.21

small heat map img

GM12878
Myers
EGR1
ENCSR000BMQ
r=0.20

small heat map img

GM12878
Myers
POLR2A
ENCSR000EYW
r=0.19

small heat map img

GM12878
Myers
RXRA
ENCSR000BJD
r=0.18

small heat map img

GM12878
Myers
POLR2A
ENCSR000DKT
r=0.18

small heat map img

GM12878
Myers
PBX3
ENCSR000BGR
r=0.18

small heat map img

GM12878
Myers
NFYA
ENCSR000DNN
r=0.18

small heat map img

GM12878
Myers
CTCF
ENCSR000DZN
r=0.17

small heat map img

GM12878
Myers
RAD21
ENCSR000BMY
r=0.16

small heat map img

GM12878
Myers
KAT2A
ENCSR000DNO
r=0.15

small heat map img

GM12878
Myers
MEF2C
ENCSR000BNG
r=0.15

small heat map img

GM12878
Myers
SIX5
ENCSR000BJE
r=0.15

small heat map img

GM12878
Myers
SUPT20H
ENCSR000DNP
r=0.15

small heat map img

GM12878
Myers
TAF1
ENCSR000BGS
r=0.14

small heat map img

GM12878
Myers
ZBTB33
ENCSR000BHC
r=0.13

small heat map img

GM12878
Myers
POLR2A
ENCSR000BGD
r=0.13

small heat map img

GM12878
Myers
CTCF
ENCSR000DKV
r=0.12

small heat map img

GM12878
Myers
NR2C2
ENCSR000EUL
r=0.10

small heat map img

GM12878
Myers
CTCF
ENCSR000AKB
r=0.10

small heat map img

GM12878
Myers
POLR3G
ENCSR000EYU
r=0.08

small heat map img

GM12878
Myers
EGR1
ENCSR000BRG
r=0.08

small heat map img

GM12878
Myers
USF1
ENCSR000BGI
r=0.08

small heat map img

GM12878
Myers
ZEB1
ENCSR000BND
r=0.07

small heat map img

GM12878
Myers
GABPA
ENCSR000BGC
r=0.07

small heat map img

GM12878
Myers
ATF3
ENCSR000BJY
r=0.06

small heat map img

GM12878
Myers
CTCF
ENCSR000DRZ
r=0.06

small heat map img

GM12878
Myers
SRF
ENCSR000BGE
r=0.05

small heat map img

GM12878
Myers
REST
ENCSR000BQS
r=0.05

small heat map img

GM12878
Myers
REST
ENCSR000BGF
r=0.04

small heat map img

GM12878
Myers
ZZZ3
ENCSR000DNQ
r=0.01

small heat map img

GM12878
Myers
ZNF274
ENCSR000EUK
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 17,876 (download )

H1-hESC - Myers - ENCSR000BIP

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=1.00

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.46

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.42

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.40

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.40

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.40

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.40

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.39

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.38

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.37

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.37

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.34

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.34

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.33

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.33

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.32

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.32

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.31

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.31

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.31

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.30

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.29

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.29

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.29

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.27

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.27

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.27

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.26

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.25

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.24

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.23

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.22

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.21

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.20

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.20

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.17

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.17

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.16

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.16

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.16

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.15

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.15

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.15

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.14

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.14

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.14

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.14

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=0.13

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.13

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.12

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.12

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.11

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.11

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.11

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.10

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.10

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.10

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.10

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.10

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.09

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.09

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.08

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.07

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.07

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.06

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.06

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.05

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.04

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.02

small heat map img
2,518 peaks (download )

H1-hESC - Myers - ENCSR000BMJ

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=1.00

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.50

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.47

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.46

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.43

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.43

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.42

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.42

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.41

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.40

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.40

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.39

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.39

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.39

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.39

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.38

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.37

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.37

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.37

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.36

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.36

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.35

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.34

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.34

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.32

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.31

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.31

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.31

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.30

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.30

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.29

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.29

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.29

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.28

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.27

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.26

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.25

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.23

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.23

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.23

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.22

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.22

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.21

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.21

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.21

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.20

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.19

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.19

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.19

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.19

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.18

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.18

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.18

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.17

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.17

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.17

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=0.17

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.15

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.15

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.14

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.14

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.14

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.14

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.13

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.13

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.13

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.12

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.09

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.06

small heat map img
1,370 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHA

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help